Review





Similar Products

lentiviral vectors  (OriGene)
90
OriGene lentiviral vectors
Lentiviral Vectors, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+stat3+shrnas/STAT3+Human+shRNA+Lentiviral+Particle/pmc07153827-235-13-10
Average 90 stars, based on 1 article reviews
lentiviral vectors - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
human stat3 gene specific shrna plasmid  (Santa Cruz Biotechnology)
96
Santa Cruz Biotechnology human stat3 gene specific shrna plasmid
Human Stat3 Gene Specific Shrna Plasmid, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+stat3+shrnas/Stat3/pm32242147-203-1-13
Average 96 stars, based on 1 article reviews
human stat3 gene specific shrna plasmid - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier
human stat3 -shrna (sequence: ccgggcacaatctacgaagaatcaactcgagttgattcttcgtagattgtgctttttg)  (Millipore)
90
Millipore human stat3 -shrna (sequence: ccgggcacaatctacgaagaatcaactcgagttgattcttcgtagattgtgctttttg)
KRASG12D promotes macrophage M2 polarization via <t>STAT3-dependent</t> fatty acid oxidation. (A) Heat map of mRNA expression of M1 and M2 genes in the indicated wild-type (WT) or KRASG12D-driven PBMCMs in the absence or presence of exosomes (100 μg/ml) or etomoxir (5 µM) for 24 h. (B) Analysis of fatty acid oxidation level in WT or KRASG12D-driven PBMCMs in the absence or presence of exosomes (100 μg/ml) or etomoxir (5 µM) for 24 h. (C) Western blot analysis of STAT3 and p-STAT3 expression in the indicated PBMCMs with or without KRASG12D transfection or exosome treatment (100 μg/ml) for 24 h. (D) Heat map of mRNA expression of fatty acid oxidation-related genes in indicated WT or KRASG12D-driven PBMCMs
Human Stat3 Shrna (Sequence: Ccgggcacaatctacgaagaatcaactcgagttgattcttcgtagattgtgctttttg), supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+stat3+shrnas/stat+3+5/pmc07595620-320-29-9
Average 90 stars, based on 1 article reviews
human stat3 -shrna (sequence: ccgggcacaatctacgaagaatcaactcgagttgattcttcgtagattgtgctttttg) - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
tl301348v  (OriGene)
90
OriGene tl301348v
KRASG12D promotes macrophage M2 polarization via <t>STAT3-dependent</t> fatty acid oxidation. (A) Heat map of mRNA expression of M1 and M2 genes in the indicated wild-type (WT) or KRASG12D-driven PBMCMs in the absence or presence of exosomes (100 μg/ml) or etomoxir (5 µM) for 24 h. (B) Analysis of fatty acid oxidation level in WT or KRASG12D-driven PBMCMs in the absence or presence of exosomes (100 μg/ml) or etomoxir (5 µM) for 24 h. (C) Western blot analysis of STAT3 and p-STAT3 expression in the indicated PBMCMs with or without KRASG12D transfection or exosome treatment (100 μg/ml) for 24 h. (D) Heat map of mRNA expression of fatty acid oxidation-related genes in indicated WT or KRASG12D-driven PBMCMs
Tl301348v, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+stat3+shrnas/STAT3+Human+shRNA+Lentiviral+Particle/10__1080_slash_2162402x__2020__1729299-181-15-10
Average 90 stars, based on 1 article reviews
tl301348v - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
shrna gli3 sequences  (OriGene)
90
OriGene shrna gli3 sequences
KRASG12D promotes macrophage M2 polarization via <t>STAT3-dependent</t> fatty acid oxidation. (A) Heat map of mRNA expression of M1 and M2 genes in the indicated wild-type (WT) or KRASG12D-driven PBMCMs in the absence or presence of exosomes (100 μg/ml) or etomoxir (5 µM) for 24 h. (B) Analysis of fatty acid oxidation level in WT or KRASG12D-driven PBMCMs in the absence or presence of exosomes (100 μg/ml) or etomoxir (5 µM) for 24 h. (C) Western blot analysis of STAT3 and p-STAT3 expression in the indicated PBMCMs with or without KRASG12D transfection or exosome treatment (100 μg/ml) for 24 h. (D) Heat map of mRNA expression of fatty acid oxidation-related genes in indicated WT or KRASG12D-driven PBMCMs
Shrna Gli3 Sequences, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+stat3+shrnas/STAT3+Human+shRNA+Plasmid+Kit/pm30272273-88-10-12
Average 90 stars, based on 1 article reviews
shrna gli3 sequences - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
shrna control shrna against stat3  (OriGene)
90
OriGene shrna control shrna against stat3
KRASG12D promotes macrophage M2 polarization via <t>STAT3-dependent</t> fatty acid oxidation. (A) Heat map of mRNA expression of M1 and M2 genes in the indicated wild-type (WT) or KRASG12D-driven PBMCMs in the absence or presence of exosomes (100 μg/ml) or etomoxir (5 µM) for 24 h. (B) Analysis of fatty acid oxidation level in WT or KRASG12D-driven PBMCMs in the absence or presence of exosomes (100 μg/ml) or etomoxir (5 µM) for 24 h. (C) Western blot analysis of STAT3 and p-STAT3 expression in the indicated PBMCMs with or without KRASG12D transfection or exosome treatment (100 μg/ml) for 24 h. (D) Heat map of mRNA expression of fatty acid oxidation-related genes in indicated WT or KRASG12D-driven PBMCMs
Shrna Control Shrna Against Stat3, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+stat3+shrnas/STAT3+Human+shRNA+Plasmid+Kit/pm29855616-204-4-12
Average 90 stars, based on 1 article reviews
shrna control shrna against stat3 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
lentiviral vectors expressing shrnas against human pml, stat3 and sox9 from the mission shrna library  (Addgene inc)
90
Addgene inc lentiviral vectors expressing shrnas against human pml, stat3 and sox9 from the mission shrna library
KRASG12D promotes macrophage M2 polarization via <t>STAT3-dependent</t> fatty acid oxidation. (A) Heat map of mRNA expression of M1 and M2 genes in the indicated wild-type (WT) or KRASG12D-driven PBMCMs in the absence or presence of exosomes (100 μg/ml) or etomoxir (5 µM) for 24 h. (B) Analysis of fatty acid oxidation level in WT or KRASG12D-driven PBMCMs in the absence or presence of exosomes (100 μg/ml) or etomoxir (5 µM) for 24 h. (C) Western blot analysis of STAT3 and p-STAT3 expression in the indicated PBMCMs with or without KRASG12D transfection or exosome treatment (100 μg/ml) for 24 h. (D) Heat map of mRNA expression of fatty acid oxidation-related genes in indicated WT or KRASG12D-driven PBMCMs
Lentiviral Vectors Expressing Shrnas Against Human Pml, Stat3 And Sox9 From The Mission Shrna Library, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+stat3+shrnas/tet+o+sox9+puro/pm27553708-212-9-20
Average 90 stars, based on 1 article reviews
lentiviral vectors expressing shrnas against human pml, stat3 and sox9 from the mission shrna library - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


KRASG12D promotes macrophage M2 polarization via STAT3-dependent fatty acid oxidation. (A) Heat map of mRNA expression of M1 and M2 genes in the indicated wild-type (WT) or KRASG12D-driven PBMCMs in the absence or presence of exosomes (100 μg/ml) or etomoxir (5 µM) for 24 h. (B) Analysis of fatty acid oxidation level in WT or KRASG12D-driven PBMCMs in the absence or presence of exosomes (100 μg/ml) or etomoxir (5 µM) for 24 h. (C) Western blot analysis of STAT3 and p-STAT3 expression in the indicated PBMCMs with or without KRASG12D transfection or exosome treatment (100 μg/ml) for 24 h. (D) Heat map of mRNA expression of fatty acid oxidation-related genes in indicated WT or KRASG12D-driven PBMCMs

Journal: Autophagy

Article Title: Autophagy-dependent ferroptosis drives tumor-associated macrophage polarization via release and uptake of oncogenic KRAS protein

doi: 10.1080/15548627.2020.1714209

Figure Lengend Snippet: KRASG12D promotes macrophage M2 polarization via STAT3-dependent fatty acid oxidation. (A) Heat map of mRNA expression of M1 and M2 genes in the indicated wild-type (WT) or KRASG12D-driven PBMCMs in the absence or presence of exosomes (100 μg/ml) or etomoxir (5 µM) for 24 h. (B) Analysis of fatty acid oxidation level in WT or KRASG12D-driven PBMCMs in the absence or presence of exosomes (100 μg/ml) or etomoxir (5 µM) for 24 h. (C) Western blot analysis of STAT3 and p-STAT3 expression in the indicated PBMCMs with or without KRASG12D transfection or exosome treatment (100 μg/ml) for 24 h. (D) Heat map of mRNA expression of fatty acid oxidation-related genes in indicated WT or KRASG12D-driven PBMCMs

Article Snippet: Rnai and gene transfection The following were obtained from Sigma-Aldrich in a lentiviral format: human ATG5 -shRNA (sequence: CCGGCCTGAACAGAATCATCCTTAACTCGAGTTAAGGATGATTCTGTTCAGGTTTTTTG), human ATG7 -shRNA (sequence: CCGGGCCTGCTGAGGAGCTCTCCATCTCGAGATGGAGAGCTCCTCAGCAGGCTTTTT), human AGER -shRNA (sequence: CCGGGAACTGAATCAGTCGGAGGAACTCGAGTTCCTCCGACTGATTCAGTTCTTTTTG), human STAT3 -shRNA (sequence: CCGGGCACAATCTACGAAGAATCAACTCGAGTTGATTCTTCGTAGATTGTGCTTTTTG), human CPT1A -shRNA (sequence: CCGGGCCATGAAGCTCTTAGACAAACTCGAGTTTGTCTAAGAGCTTCATGGCTTTTTG), human ACADM -shRNA (sequence: CCGGGTGCAGATACTTGGAGGCAATCTCGAGATTGCCTCCAAGTATCTGCACTTTTT), and human RAB27A -shRNA (sequence: CCGGCCAGTGTACTTTACCAATATACTCGAGTATATTGGTAAAGTACACTGGTTTTT).

Techniques: Expressing, Western Blot, Transfection